After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus BMP10 Информация о продукте «Клон cDNA»
Размер кДНК:1275bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein 10 with C terminal Myc tag.
Синоним гена:BMP10
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90070-ACGRBS15400
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90070-ACRRBS15400
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90070-CFRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90070-CHRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90070-CMRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90070-CYRBS13340
Резус-фактор BMP-10 Джин клон кДНК в вектор клонированияCG90070-GRBS5130
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90070-NFRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90070-NHRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90070-NMRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90070-NYRBS13340
Резус-фактор BMP-10 Джин ORF экспрессии кДНК клона плазмидыCG90070-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90070-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.