After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus B3GNT1 Информация о продукте «Клон cDNA»
Размер кДНК:1248bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 with N terminal Myc tag.
Синоним гена:B3GNT1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90818-ACGRBS15400
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90818-ACRRBS15400
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90818-CFRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90818-CHRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90818-CMRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90818-CYRBS13340
Яванский макак B3GNT1 Джин клон кДНК в вектор клонированияCG90818-GRBS5130
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90818-NFRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90818-NHRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90818-NMRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90818-NYRBS13340
Яванский макак B3GNT1 Джин ORF экспрессии кДНК клона плазмидыCG90818-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90818-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.