After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ATP6V1E1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001283521.1
Размер кДНК:681bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866302.
Синоним гена:ATP6V1E1
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90766-ACGRBS15400
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90766-ACRRBS15400
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90766-ANGRBS15400
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90766-ANRRBS15400
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90766-CFRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90766-CHRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90766-CMRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90766-CYRBS13340
Яванский макак ATP6V1E1 Джин клон кДНК в вектор клонированияCG90766-GRBS5130
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90766-NFRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90766-NHRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90766-NMRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90766-NYRBS13340
Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмидыCG90766-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90766-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».