Быстрый заказ

Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак ATP6V1E1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001283521.1
    Размер кДНК:681bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866302.
    Синоним гена:ATP6V1E1
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90766-ACGRBS15400
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90766-ACRRBS15400
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90766-ANGRBS15400
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90766-ANRRBS15400
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90766-CFRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90766-CHRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90766-CMRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90766-CYRBS13340
    Яванский макак ATP6V1E1 Джин клон кДНК в вектор клонированияCG90766-GRBS5130
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90766-NFRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90766-NHRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90766-NMRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90766-NYRBS13340
    Яванский макак ATP6V1E1 Джин ORF экспрессии кДНК клона плазмидыCG90766-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».