Быстрый заказ

Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ATP1A2 Информация о продукте «Клон cDNA»
Размер кДНК:3063bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ATPase, Na+>K+ transporting, alpha 2 polypeptide with C terminal His tag.
Синоним гена:ATP1A2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90828-ACGRBS22238
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90828-ACRRBS22238
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90828-CFRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90828-CHRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90828-CMRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90828-CYRBS20185
Яванский макак ATP1A2 Джин клон кДНК в вектор клонированияCG90828-GRBS5132
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90828-NFRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90828-NHRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90828-NMRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90828-NYRBS20185
Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмидыCG90828-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90828-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.