Быстрый заказ

Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак ATP1A2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005541270.1
    Размер кДНК:3063bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ATPase, Na+>K+ transporting, alpha 2 polypeptide with C terminal His tag.
    Синоним гена:ATP1A2
    Виды:Cynomolgus
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90828-ACGRBS22240
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90828-ACRRBS22240
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90828-CFRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90828-CHRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90828-CMRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90828-CYRBS20190
    Яванский макак ATP1A2 Джин клон кДНК в вектор клонированияCG90828-GRBS5130
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90828-NFRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90828-NHRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90828-NMRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90828-NYRBS20190
    Яванский макак ATP1A2 Джин ORF экспрессии кДНК клона плазмидыCG90828-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».