Быстрый заказ

Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак ARPC4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005547742.1
    Размер кДНК:507bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) actin related protein 2/3 complex, subunit 4, 20kDa with C terminal HA tag.
    Синоним гена:ARPC4
    Виды:Cynomolgus
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90399-ACGRBS15400
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90399-ACRRBS15400
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90399-ANGRBS15400
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90399-ANRRBS15400
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90399-CFRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90399-CHRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90399-CMRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90399-CYRBS13340
    Яванский макак ARPC4 Джин клон кДНК в вектор клонированияCG90399-GRBS5130
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90399-NFRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90399-NHRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90399-NMRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90399-NYRBS13340
    Яванский макак ARPC4 Джин ORF экспрессии кДНК клона плазмидыCG90399-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90399-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».