After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ARF3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005570735.1
Размер кДНК:546bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
Синоним гена:ARF3
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90751-ACGRBS15396
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90751-ACRRBS15396
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90751-CFRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90751-CHRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90751-CMRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90751-CYRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин клон кДНК в вектор клонированияCG90751-GRBS5132
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90751-NFRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90751-NHRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90751-NMRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90751-NYRBS13343
Яванский макак ARF3 / ADP-ribosylation factor 3 Джин ORF экспрессии кДНК клона плазмидыCG90751-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

Ссылки
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Каталог: CG90751-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».