After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus APEX1 Информация о продукте «Клон cDNA»
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) APEX nuclease (multifunctional DNA repair enzyme) 1 with C terminal Myc tag.
Синоним гена:APEX1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90434-ACGRBS15400
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90434-ACRRBS15400
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90434-ANGRBS15400
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90434-ANRRBS15400
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90434-CFRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90434-CHRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90434-CMRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90434-CYRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин клон кДНК в вектор клонированияCG90434-GRBS5130
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90434-NFRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90434-NHRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90434-NMRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90434-NYRBS13340
Резус-фактор APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмидыCG90434-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Каталог: CG90434-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.