FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-HA tag

Price:
Size:
Number:

FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-HA tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
2133 bp
Description
Full length Clone DNA of Cynomolgus amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FE65/APBB1 Background Information

Amyloid beta precursor protein binding family B member 1(APBB1) was first identified as a binding partner of amyloid precursor protein during brain development, That APBB1 regulates activation of nuclear factor-kappaB, which is involved in reducing various stresses including oxidative stress, which suggests that APBB1 is associated with gamma-radiation sensitivity. Our findings imply that APBB1 plays an important role in the maintenance of EMT-associated CSC-like properties and gamma-radiation resistance via activation of IGF1Rbeta/AKT/GSK3beta pathway in lung cancer cells, highlighting APBB1 as a potential target for therapeutic cancer treatment. A genetic polymorphism in intron 13 of the FE65 gene (APBB1) was reported to be associated with Alzheimer's disease (AD).
Full Name
amyloid beta precursor protein binding family B member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait