After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus APBB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005578803.1
Размер кДНК:2133bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) with N terminal HA tag.
Синоним гена:APBB1
Виды:Cynomolgus
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90407-ACGRBS16764
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90407-ACRRBS16764
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90407-ANGRBS16764
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90407-ANRRBS16764
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90407-CFRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90407-CHRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90407-CMRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90407-CYRBS14711
Яванский макак FE65/APBB1 Джин клон кДНК в вектор клонированияCG90407-GRBS5132
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90407-NFRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90407-NHRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90407-NMRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90407-NYRBS14711
Яванский макак FE65/APBB1 Джин ORF экспрессии кДНК клона плазмидыCG90407-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90407-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».