Быстрый заказ

Text Size:AAA

Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus AGPAT4 Информация о продукте «Клон cDNA»
Размер кДНК:1137bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) 1-acyl-sn-glycerol-3-phosphate acyltransferase delta with N terminal Myc tag.
Синоним гена:AGPAT4
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90655-ACGRBS15400
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90655-ACRRBS15400
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90655-CFRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90655-CHRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90655-CMRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90655-CYRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин клон кДНК в вектор клонированияCG90655-GRBS5130
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90655-NFRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90655-NHRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90655-NMRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90655-NYRBS13340
Яванский макак 1-AGP acyltransferase 4/AGPAT4 Джин ORF экспрессии кДНК клона плазмидыCG90655-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90655-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.