After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ACVRL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001091113.2
Размер кДНК:1512bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor type II-like 1 with C terminal Myc tag.
Синоним гена:ACVRL1
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90060-ACGRBS16764
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90060-ACRRBS16764
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90060-CFRBS14711
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90060-CHRBS14711
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90060-CMRBS14710
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90060-CYRBS14711
Резус-фактор ALK-1/ACVRL1 Джин клон кДНК в вектор клонированияCG90060-GRBS5132
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90060-NFRBS14711
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90060-NHRBS14710
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90060-NMRBS14710
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90060-NYRBS14711
Резус-фактор ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмидыCG90060-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.

Ссылки
  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • Size / Price
    Каталог: CG90060-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».