Быстрый заказ

Text Size:AAA

Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ACVR1C Информация о продукте «Клон cDNA»
Размер кДНК:1482bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor, type IC with C terminal Myc tag.
Синоним гена:ACVR1C
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90067-ACGRBS15400
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90067-ACRRBS15400
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90067-CFRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90067-CHRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90067-CMRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90067-CYRBS13340
Резус-фактор ALK-7 / ACVR1C Джин клон кДНК в вектор клонированияCG90067-GRBS5130
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90067-NFRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90067-NHRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90067-NMRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90067-NYRBS13340
Резус-фактор ALK-7 / ACVR1C Джин ORF экспрессии кДНК клона плазмидыCG90067-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.

  • Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. Nature. 482(7384):251-5.
  • He C, et al. (2010) A large-scale candidate gene association study of age at menarche and age at natural menopause. Hum Genet. 128(5):515-27.
  • Watanabe R, et al. (2008) Insulin gene is a target in activin receptor-like kinase 7 signaling pathway in pancreatic beta-cells. Biochem Biophys Res Commun. 377(3):867-72.
  • Size / Price
    Каталог: CG90067-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.