After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ACVR1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001091363.2
Размер кДНК:1518bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor, type IB with C terminal Myc tag.
Синоним гена:ACVR1B
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90066-ACGRBS16760
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90066-ACRRBS16760
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90066-CFRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90066-CHRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90066-CMRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90066-CYRBS14710
Резус-фактор ALK-4 / ACVR1B Джин клон кДНК в вектор клонированияCG90066-GRBS5130
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90066-NFRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90066-NHRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90066-NMRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90066-NYRBS14710
Резус-фактор ALK-4 / ACVR1B Джин ORF экспрессии кДНК клона плазмидыCG90066-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

Ссылки
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • Size / Price
    Каталог: CG90066-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».