After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ACVR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001089033.1
Размер кДНК:1530bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor, type I with C terminal Myc tag.
Синоним гена:ACVR1
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90058-ACGRBS16760
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90058-ACRRBS16760
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90058-CFRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90058-CHRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90058-CMRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90058-CYRBS14710
Резус-фактор ALK-2/ACVR1 Джин клон кДНК в вектор клонированияCG90058-GRBS5130
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90058-NFRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90058-NHRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90058-NMRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90058-NYRBS14710
Резус-фактор ALK-2/ACVR1 Джин ORF экспрессии кДНК клона плазмидыCG90058-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability to bind activin in concert with ActRII or ActRIIB. ALK-2 is also identified as a BMP type I receptor. It has been demonstrated that ALK-2 forms complex with either the BMP-2/7-bound BMPR-II or ACVR2A /ACVR2B. ALK-1 and ALK-2 presenting in the yeast Saccharomyces cerevisiae are two haspin homologues. Both ALK-1 and ALK-2 exhibit a weak auto-kinase activity in vitro, and are phosphoproteins in vivo. ALK-1 and ALK-2 levels peak in mitosis and late-S/G2. Control of protein stability plays a major role in ALK-2 regulation. The half-life of ALK-2 is particularly short in G1. Overexpression of ALK-2, but not of ALK-1, causes a mitotic arrest, which is correlated to the kinase activity of the protein. This suggests a role for ALK-2 in the control of mitosis. Endoglin is phosphorylated on cytosolic domain threonine residues by the TGF-beta type I receptors ALK-2 and ALK-5 in prostate cancer cells. Endoglin did not inhibit cell migration in the presence of constitutively active ALK-2. Defects in ALK-2 are a cause of fibrodysplasia ossificans progressiva (FOP).

Ссылки
  • Armes NA,et al. (1997) The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124(19): 3797-804.
  • Armes NA, et al. (1999) A short loop on the ALK-2 and ALK-4 activin receptors regulates signaling specificity but cannot account for all their effects on early Xenopus development. J Biol Chem. 274(12):7929-35.
  • Kawai S, et al. (2000) Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity.Biochem Biophys Res Commun. 271(3):682-7.
  • Deng Y, et al. (2009) Efficient highly selective synthesis of methyl 2-(ethynyl)alk-2(E)-enoates and 2-(1'-chlorovinyl)alk-2(Z)-enoates from 2-(methoxycarbonyl)-2,3-allenols. Organic letters 11(10):2169-72.
  • Size / Price
    Каталог: CG90058-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».