After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ACTL6B Информация о продукте «Клон cDNA»
Размер кДНК:1281bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) actin-like 6B with N terminal His tag.
Синоним гена:ACTL6B
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90607-ACGRBS15400
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90607-ACRRBS15400
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90607-ANGRBS15400
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90607-ANRRBS15400
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90607-CFRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90607-CHRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90607-CMRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90607-CYRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин клон кДНК в вектор клонированияCG90607-GRBS5130
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90607-NFRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90607-NHRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90607-NMRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90607-NYRBS13340
Яванский макак Actin-like Белок 6B/BAF53b Джин ORF экспрессии кДНК клона плазмидыCG90607-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90607-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.