After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD3E Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001097204.2
Размер кДНК:597bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD3e molecule, epsilon (CD3-TCR complex) with C terminal Myc tag.
Синоним гена:CD3e
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:pCMV3-cynoCD3E-Myc
Участок рестрикции:KpnI + XbaI (6kb + 0.64kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence. Please check the sequence information before order.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus CD3E Gene Plasmid Map
Cynomolgus CD3E natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90047-ACGRBS15400
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90047-ACRRBS15400
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90047-CFRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90047-CHRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90047-CMRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90047-CYRBS13340
Резус-фактор CD3e/CD3 epsilon Джин клон кДНК в вектор клонированияCG90047-GRBS5130
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90047-NFRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90047-NHRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90047-NMRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90047-NYRBS13340
Резус-фактор CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмидыCG90047-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

Ссылки
  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • Size / Price
    Каталог: CG90047-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Cynomolgus CD3E natural ORF mammalian expression plasmid, C-Myc tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».