After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine WFDC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001003241.1
Размер кДНК:525bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris WAP four-disulfide core domain 2 with C terminal Flag tag.
Синоним гена:CE4
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70012-ACGRBS15400
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70012-ACRRBS15400
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70012-CFRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70012-CHRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70012-CMRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70012-CYRBS13340
Собачий HE4/WFDC2/WAP5 Джин клон кДНК в вектор клонированияDG70012-GRBS5130
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70012-NFRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70012-NHRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70012-NMRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70012-NYRBS13340
Собачий HE4/WFDC2/WAP5 Джин ORF экспрессии кДНК клона плазмидыDG70012-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

Ссылки
  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellström,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.
  • Size / Price
    Каталог: DG70012-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».