After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine SRSF3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_532124.4
Размер кДНК:495bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris serine/arginine-rich splicing factor 3 with C terminal His tag.
Синоним гена:SFRS3, SRP20
Виды:Canine
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70218-ACGRBS15400
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70218-ACRRBS15400
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70218-ANGRBS15400
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70218-ANRRBS15400
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70218-CFRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70218-CHRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70218-CMRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70218-CYRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70218-NFRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70218-NHRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70218-NMRBS13340
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70218-NYRBS13340
Собачий SRSF3 Джин клон кДНК в вектор клонированияDG70218-URBS5130
Собачий SRSF3 Джин ORF экспрессии кДНК клона плазмидыDG70218-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70218-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».