SPARCL1 cDNA ORF Clone, Canine, C-HA tag

Price:
Size:
Number:

SPARCL1 cDNA ORF Clone, Canine, C-HA tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
2004 bp
Description
Full length Clone DNA of Canine SPARC-like 1 (hevin) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SPARCL1 Background Information

SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).
Full Name
SPARC like 1
References
  • Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.
  • Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.
  • Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait