Быстрый заказ

Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий SPARCL1 Информация о продукте «Клон cDNA»
    Размер кДНК:2004bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris SPARC-like 1 (hevin) with C terminal HA tag.
    Синоним гена:SPARCL1
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70239-ACGRBS16760
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70239-ACRRBS16760
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70239-CFRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70239-CHRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70239-CMRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70239-CYRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70239-NFRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70239-NHRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70239-NMRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70239-NYRBS14710
    Собачий SPARCL1 / SPARC-like 1 Джин клон кДНК в вектор клонированияDG70239-URBS5130
    Собачий SPARCL1 / SPARC-like 1 Джин ORF экспрессии кДНК клона плазмидыDG70239-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).

  • Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.
  • Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.
  • Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.
  • Size / Price
    Каталог: DG70239-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.