Быстрый заказ

Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine SNX3 Информация о продукте «Клон cDNA»
Размер кДНК:489bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris sorting nexin 3 with C terminal His tag.
Синоним гена:SNX3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70201-ACGRBS15396
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70201-ACRRBS15396
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70201-ANGRBS15396
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70201-ANRRBS15396
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70201-CFRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70201-CHRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70201-CMRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70201-CYRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70201-NFRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70201-NHRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70201-NMRBS13343
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70201-NYRBS13343
Собачий SNX3 Джин клон кДНК в вектор клонированияDG70201-URBS5132
Собачий SNX3 Джин ORF экспрессии кДНК клона плазмидыDG70201-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70201-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.