After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine SELT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001164487.1
Размер кДНК:588bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris selenoprotein T with C terminal His tag.
Синоним гена:SELT
Виды:Canine
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70202-ACGRBS15396
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70202-ACRRBS15396
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70202-CFRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70202-CHRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70202-CMRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70202-CYRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70202-NFRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70202-NHRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70202-NMRBS13343
Собачий SELT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70202-NYRBS13343
Собачий SELT Джин клон кДНК в вектор клонированияDG70202-URBS5132
Собачий SELT Джин ORF экспрессии кДНК клона плазмидыDG70202-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70202-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».