Быстрый заказ

Text Size:AAA

Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine RNF114 Информация о продукте «Клон cDNA»
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris ring finger protein 114 with C terminal HA tag.
Синоним гена:ZNF313
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70238-ACGRBS15400
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70238-ACRRBS15400
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70238-ANGRBS15400
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70238-ANRRBS15400
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70238-CFRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70238-CHRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70238-CMRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70238-CYRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70238-NFRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70238-NHRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70238-NMRBS13340
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70238-NYRBS13340
Собачий RNF114 Джин клон кДНК в вектор клонированияDG70238-URBS5130
Собачий RNF114 Джин ORF экспрессии кДНК клона плазмидыDG70238-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70238-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.