Быстрый заказ

Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий RBP4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_534969.2
    Размер кДНК:606bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris retinol binding protein 4, plasma with C terminal Flag tag.
    Синоним гена:RBP4
    Виды:Canine
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70006-ACGRBS15400
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70006-ACRRBS15400
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70006-CFRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70006-CHRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70006-CMRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70006-CYRBS13340
    Собачий RBP4 Джин клон кДНК в вектор клонированияDG70006-GRBS5130
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70006-NFRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70006-NHRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70006-NMRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70006-NYRBS13340
    Собачий RBP4 Джин ORF экспрессии кДНК клона плазмидыDG70006-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible for the conversion of unstable and insoluble retinol in aqueous solution into stable and soluble complex in plasma through their tight interaction. As a member of the lipocalin superfamily, RBP4 containing a β-barrel structure with a well-defined cavity is secreted from the liver, and in turn delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP4-retinol complex interacts with transthyretin (TTR), and this binding is crucial for preventing RBP4 excretion through the kidney glomeruli. RBP4 expressed from an ectopic source efficiently delivers retinol to the eyes, and its deficiency affects night vision largely. Recently, RBP4 as an adipokine, is found to be expressed in adipose tissue and correlated with obesity, insulin resistance (IR) and type 2 diabetes (T2DM).

    Ссылки
  • Yang Q, et al. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature. 436(7049): 356-62.
  • Choi SH, et al. (2008) High plasma retinol binding protein-4 and low plasma adiponectin concentrations are associated with severity of glucose intolerance in women with previous gestational diabetes mellitus. J Clin Endocrinol Metab. 93(8): 3142-8.
  • Tepper BJ, et al. (2010) Serum retinol-binding protein 4 (RBP4) and retinol in a cohort of borderline obese women with and without gestational diabetes. Clin Biochem. 43(3): 320-3.
  • Size / Price
    Каталог: DG70006-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».