Быстрый заказ

Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий PRDX3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001256485.1
    Размер кДНК:774bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris peroxiredoxin 3 with C terminal His tag.
    Синоним гена:AOP1
    Виды:Canine
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70217-ACGRBS15400
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70217-ACRRBS15400
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70217-ANGRBS15400
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70217-ANRRBS15400
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70217-CFRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70217-CHRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70217-CMRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70217-CYRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70217-NFRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70217-NHRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70217-NMRBS13340
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70217-NYRBS13340
    Собачий PRDX3 Джин клон кДНК в вектор клонированияDG70217-URBS5130
    Собачий PRDX3 Джин ORF экспрессии кДНК клона плазмидыDG70217-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».