After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine NTRK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_003432718.1
Размер кДНК:2469bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris neurotrophic tyrosine kinase, receptor, type 2 with C terminal Flag tag.
Синоним гена:NTRK2
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70035-ACGRBS16760
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70035-ACRRBS16760
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70035-CFRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70035-CHRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70035-CMRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70035-CYRBS14710
Собачий TrkB/NTRK2 Джин клон кДНК в вектор клонированияDG70035-GRBS5130
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70035-NFRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70035-NHRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70035-NMRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70035-NYRBS14710
Собачий TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмидыDG70035-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

Ссылки
  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Size / Price
    Каталог: DG70035-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».