Быстрый заказ

Text Size:AAA

Canine NME1 ORF mammalian expression plasmid, C-His tag

ПаспортОбзорыСвязанные продуктыПротоколы
Canine NME1 Информация о продукте «Клон cDNA»
Размер кДНК:459bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris non-metastatic cells 1, protein (NM23A) expressed in with C terminal His tag.
Синоним гена:NM23A, NM23-C1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

NME1, also known as Nucleoside Diphosphate Kinase A (NDK-A), or NM23-H1, belongs to the NDK family. NM23-H1 is known to have a metastasis suppressive activity in many tumor cells. Recent studies have shown that the interacting proteins with NM23-H1 which mediate the cell proliferation, may act as modulators of the metastasis suppressor activity. The interacting proteins with NM23-H1 can be classified into 3 groups. The first group of proteins can be classified as upstream kinases of NM23-H1 such as CKI and Aurora-A/STK15. The second group of proteins acts as downstream effectors for the regulation of specific gene transcriptions, GTP-binding protein functions, and signal transduction in Erk signal cascade. The third group of proteins can be classified as bi-directionally influencing binding partners of NM23-H1. As a result, the interactions with NM23-H1 and binding partners have implications in the biochemical characterization involved in metastasis and tumorigenesis. NDKA is increased in human postmortem cerebrospinal fluid (CSF), a model of global brain insult, suggesting that measurement in CSF and, more importantly, in plasma may be useful as a biomarker of stroke. Additionally, NM23-H1 significantly reduces metastasis without effects on primary tumor size and was the first discovered metastasis suppressor gene.

  • Allard L, et al. (2005) PARK7 and nucleoside diphosphate kinase A as plasma markers for the early diagnosis of stroke. Clin Chem. 51(11): 2043-51.
  • Steeg PS, et al. (2008) Clinical-translational approaches to the Nm23-H1 metastasis suppressor. Clin Cancer Res. 14(16): 5006-12.
  • Kim HD, et al. (2009) Regulators affecting the metastasis suppressor activity of Nm23-H1. Mol Cell Biochem. 329(1-2): 167-73.
  • Size / Price
    Каталог: DG70213-CH
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
     Инструкции по доставке
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.