Быстрый заказ

Text Size:AAA

Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine NGF Информация о продукте «Клон cDNA»
Размер кДНК:726bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris nerve growth factor (beta polypeptide) with C terminal Flag tag.
Синоним гена:NGFB, NGF
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70027-ACGRBS15400
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70027-ACRRBS15400
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70027-CFRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70027-CHRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70027-CMRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70027-CYRBS13340
Собачий NGF/NGFB/beta-NGF Джин клон кДНК в вектор клонированияDG70027-GRBS5130
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70027-NFRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70027-NHRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70027-NMRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70027-NYRBS13340
Собачий NGF/NGFB/beta-NGF Джин ORF экспрессии кДНК клона плазмидыDG70027-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.
  • Size / Price
    Каталог: DG70027-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.