Быстрый заказ

Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий MRPS5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_532953.4
    Размер кДНК:1293bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris mitochondrial ribosomal protein S5 with C terminal His tag.
    Синоним гена:MRPS5
    Виды:Canine
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70219-ACGRBS15400
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70219-ACRRBS15400
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70219-ANGRBS15400
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70219-ANRRBS15400
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70219-CFRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70219-CHRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70219-CMRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70219-CYRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70219-NFRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70219-NHRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70219-NMRBS13340
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70219-NYRBS13340
    Собачий MRPS5 Джин клон кДНК в вектор клонированияDG70219-URBS5130
    Собачий MRPS5 Джин ORF экспрессии кДНК клона плазмидыDG70219-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: DG70219-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».