Быстрый заказ

Text Size:AAA

Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine MLLT11 Информация о продукте «Клон cDNA»
Размер кДНК:273bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 with C terminal His tag.
Синоним гена:MLLT11
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70193-ACGRBS15400
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70193-ACRRBS15400
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70193-ANGRBS15400
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70193-ANRRBS15400
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70193-CFRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70193-CHRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70193-CMRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70193-CYRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70193-NFRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70193-NHRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70193-NMRBS13340
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70193-NYRBS13340
Собачий MLLT11 Джин клон кДНК в вектор клонированияDG70193-URBS5130
Собачий MLLT11 Джин ORF экспрессии кДНК клона плазмидыDG70193-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70193-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.