Быстрый заказ

Text Size:AAA

Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine MFAP3L Информация о продукте «Клон cDNA»
Размер кДНК:1227bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris microfibrillar-associated protein 3-like with C terminal HA tag.
Синоним гена:MFAP3L
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70235-ACGRBS15400
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70235-ACRRBS15400
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70235-CFRBS13343
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70235-CHRBS13343
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70235-CMRBS13343
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70235-CYRBS13343
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70235-NFRBS13343
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70235-NHRBS13340
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70235-NMRBS13340
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70235-NYRBS13343
Собачий MFAP3L Джин клон кДНК в вектор клонированияDG70235-URBS5130
Собачий MFAP3L Джин ORF экспрессии кДНК клона плазмидыDG70235-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70235-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.