Быстрый заказ

Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Собачий MAP1LC3B Информация о продукте «Клон cDNA»
Размер кДНК:378bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris microtubule-associated protein 1 light chain 3 beta with C terminal His tag.
Синоним гена:MAP1LC3B
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70200-ACGRBS15400
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70200-ACRRBS15400
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70200-ANGRBS15400
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70200-ANRRBS15400
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70200-CFRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70200-CHRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70200-CMRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70200-CYRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70200-NFRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70200-NHRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70200-NMRBS13340
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70200-NYRBS13340
Собачий LC3B / MAP1LC3B Джин клон кДНК в вектор клонированияDG70200-URBS5130
Собачий LC3B / MAP1LC3B Джин ORF экспрессии кДНК клона плазмидыDG70200-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • Size / Price
    Каталог: DG70200-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.