Быстрый заказ

Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий LDHB Информация о продукте «Клон cDNA»
    Размер кДНК:1005bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris lactate dehydrogenase B with C terminal His tag.
    Синоним гена:LDHB
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70190-ACGRBS15400
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70190-ACRRBS15400
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70190-ANGRBS15400
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70190-ANRRBS15400
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70190-CFRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70190-CHRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70190-CMRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70190-CYRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70190-NFRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70190-NHRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70190-NMRBS13340
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70190-NYRBS13340
    Собачий LDHB Джин клон кДНК в вектор клонированияDG70190-URBS5130
    Собачий LDHB Джин ORF экспрессии кДНК клона плазмидыDG70190-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.