SCF cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Price:
Size:
Number:

SCF cDNA ORF Clone, Canine, C-DDK (Flag®) tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Canine KIT ligand with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SCF Background Information

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.
Full Name
KIT ligand
References
  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait