Быстрый заказ

Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine KITLG Информация о продукте «Клон cDNA»
Размер кДНК:825bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris KIT ligand with C terminal Flag tag.
Синоним гена:CSF, MGF, 710-712
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70010-ACGRBS15400
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70010-ACRRBS15400
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70010-CFRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70010-CHRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70010-CMRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70010-CYRBS13340
Собачий KITLG/SCF/C-kit ligand Джин клон кДНК в вектор клонированияDG70010-MRBS5130
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70010-NFRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70010-NHRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70010-NMRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70010-NYRBS13340
Собачий KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмидыDG70010-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.

  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.