Быстрый заказ

Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий IL6 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001003301.1
    Размер кДНК:624bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 6 (interferon, beta 2) with C terminal Flag tag.
    Синоним гена:IL-6, IL6
    Виды:Canine
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70015-ACGRBS15400
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70015-ACRRBS15400
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70015-CFRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70015-CHRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70015-CMRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70015-CYRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин клон кДНК в вектор клонированияDG70015-GRBS5130
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70015-NFRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70015-NHRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70015-NMRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70015-NYRBS13340
    Собачий IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмидыDG70015-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».