Быстрый заказ

Text Size:AAA

Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine IL5 Информация о продукте «Клон cDNA»
Размер кДНК:405bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 5 (colony-stimulating factor, eosinophil) with C terminal Flag tag.
Синоним гена:IL5
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70019-ACGRBS15400
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70019-ACRRBS15400
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70019-CFRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70019-CHRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70019-CMRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70019-CYRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин клон кДНК в вектор клонированияDG70019-GRBS5130
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70019-NFRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70019-NHRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70019-NMRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70019-NYRBS13340
Собачий IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмидыDG70019-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • Size / Price
    Каталог: DG70019-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.