Быстрый заказ

Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий IL4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001003159.1
    Размер кДНК:399bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 4 with C terminal Flag tag.
    Синоним гена:IL-4, IL4
    Виды:Canine
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70021-ACGRBS15400
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70021-ACRRBS15400
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70021-CFRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70021-CHRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70021-CMRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70021-CYRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин клон кДНК в вектор клонированияDG70021-GRBS5130
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70021-NFRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70021-NHRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70021-NMRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70021-NYRBS13340
    Собачий IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмидыDG70021-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.
  • Size / Price
    Каталог: DG70021-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».