After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine IL21 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001003347.1
Размер кДНК:441bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 21 with C terminal Flag tag.
Синоним гена:IL-21, IL21
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70016-ACGRBS15396
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70016-ACRRBS15396
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70016-CFRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70016-CHRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70016-CMRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70016-CYRBS13343
Собачий IL21/IL-21 Джин клон кДНК в вектор клонированияDG70016-GRBS5132
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70016-NFRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70016-NHRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70016-NMRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70016-NYRBS13343
Собачий IL21/IL-21 Джин ORF экспрессии кДНК клона плазмидыDG70016-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. IL21 is expressed in activated CD4-positive T-cells but not in CD8-positive T-cells, B-cells, or monocytes. It may promote the transition between innate and adaptive immunity. IL-21 has been tried as therapy for alleviating allergic responses. It can significantly decrease pro-inflammatory cytokines produced by T cells in addition to decreasing IgE levels in a mouse model for rhinitis (nasal passage inflammation)

Ссылки
  • Coquet JM, et al. (2007) IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 178(5):2827-34.
  • Wei L, et al. (2007) IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem. 282(48):34605-10.
  • Parrish-Novak J, et al. (2002) Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 72(5):856-63. 4 Kuchen S, et al. (2007) Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 179(9):5886-96.
  • Size / Price
    Каталог: DG70016-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».