After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine IL2 Информация о продукте «Клон cDNA»
Размер кДНК:468bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 2 with C terminal Flag tag.
Синоним гена:IL2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70014-ACGRBS15400
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70014-ACRRBS15400
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70014-CFRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70014-CHRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70014-CMRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70014-CYRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин клон кДНК в вектор клонированияDG70014-GRBS5130
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70014-NFRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70014-NHRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70014-NMRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70014-NYRBS13340
Собачий IL2/IL-2/Interleukin-2 Джин ORF экспрессии кДНК клона плазмидыDG70014-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.

  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.
  • Size / Price
    Каталог: DG70014-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.