Быстрый заказ

Text Size:AAA

Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine IL1B Информация о продукте «Клон cDNA»
Размер кДНК:798bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 1, beta with C terminal Flag tag.
Синоним гена:IL-1, IL1B
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70018-ACGRBS15396
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70018-ACRRBS15396
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70018-CFRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70018-CHRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70018-CMRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70018-CYRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин клон кДНК в вектор клонированияDG70018-GRBS5132
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70018-NFRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70018-NHRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70018-NMRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70018-NYRBS13343
Собачий IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмидыDG70018-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).

  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.
  • Size / Price
    Каталог: DG70018-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.