After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine IL1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001003157.2
Размер кДНК:798bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 1, alpha with C terminal Flag tag.
Синоним гена:IL1A
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70017-ACGRBS15400
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70017-ACRRBS15400
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70017-CFRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70017-CHRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70017-CMRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70017-CYRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин клон кДНК в вектор клонированияDG70017-GRBS5130
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70017-NFRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70017-NHRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70017-NMRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70017-NYRBS13340
Собачий IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмидыDG70017-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.

Ссылки
  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.
  • Size / Price
    Каталог: DG70017-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».