Быстрый заказ

Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Собачий IL12B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001003292.1
Размер кДНК:990bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation with C terminal Flag tag.
Синоним гена:IL12B
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70011-ACGRBS15400
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70011-ACRRBS15400
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70011-CFRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70011-CHRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70011-CMRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70011-CYRBS13340
Собачий IL12B/IL-12B Джин клон кДНК в вектор клонированияDG70011-MRBS5130
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70011-NFRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70011-NHRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70011-NMRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70011-NYRBS13340
Собачий IL12B/IL-12B Джин ORF экспрессии кДНК клона плазмидыDG70011-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Subunit beta of interleukin 12 (also known as natural killer cell stimulatory factor 2, or cytotoxic lymphocyte maturation factor 2, p40) (IL12B) is a subunit of human interleukin 12. IL12B/IL-12B is a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. IL12B/IL-12B is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. IL12B/IL-12B associates with IL23A to form the IL-23 interleukin, an heterodimeric cytokine which functions in innate and adaptive immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Ссылки
  • Taoufik Y, et al. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89 (8): 2842-8.
  • Fantuzzi L, et al. (1996) Induction of interleukin-12 (IL-12) by recombinant glycoprotein gp120 of human immunodeficiency virus type 1 in human monocytes/macrophages: requirement of gamma interferon for IL-12 secretion. J Virol. 70 (6): 4121-4.
  • Aragane Y, et al. (1995) IL-12 is expressed and released by human keratinocytes and epidermoid carcinoma cell lines. J Immunol. 153 (12): 5366-72.
  • Size / Price
    Каталог: DG70011-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».