After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine IL10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001003077.1
Размер кДНК:546bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris interleukin 10 with C terminal Flag tag.
Синоним гена:IL-10, IL10
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70022-ACGRBS15400
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70022-ACRRBS15400
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70022-CFRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70022-CHRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70022-CMRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70022-CYRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин клон кДНК в вектор клонированияDG70022-GRBS5130
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70022-NFRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70022-NHRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70022-NMRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70022-NYRBS13340
Собачий IL10/IL-10/Interleukin-10 Джин ORF экспрессии кДНК клона плазмидыDG70022-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL-10 is a anti-inflammatory cytokine which belongs to the IL-10 family. It is produced by a variety of cell lines, including T-cells, macrophages, mast cells and other cell types, while it is produced primarily by monocytes and to a lesser extent by lymphocytes. IL-10 is mainly expressed in monocytes and Type 2 T helper cells (TH2), mast cells, CD4+CD25+Foxp3+ regulatory T cells, and also in a certain subset of activated T cells and B cells. IL-10 has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. IL-10 can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. The importance of interleukin 10 for counteracting excessive immunity in the human body is revealed by the fact that patients with Crohn's disease react favorably towards treatment with bacteria producing recombinant IL-10. IL-10 inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. It also displays a potent ability to suppress the antigen-presentation capacity of antigen presenting cells. However, it is also stimulatory towards certain T cells and mast cells and stimulates B cell maturation and antibody production.

Ссылки
  • Arimoto T, et al. (2007) Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 28(6):894-906.
  • Han X, et al. (2010) Effect of cobalt protoporphyrin on hyperexpression of heme oxygenase-1 and secretion of IL-10 in rat bone marrow mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 18(5):1297-301.
  • Cui QQ, et al. (2011) Expression of RhoA in the lung tissue of acute lung injury rats and the influence of RhoA on the expression of IL-8 and IL-10. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 77(7): 1436-41.
  • Size / Price
    Каталог: DG70022-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».