IGFBP5 cDNA ORF Clone, Canine, C-HA tag

Cat: DG70042-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IGFBP5 Reagents

CRO Services

Product recommended


All IGFBP5 Reagents

IGFBP5 cDNA ORF Clone, Canine, C-HA tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Canine insulin-like growth factor binding protein 5 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP5 Background Information

Full Name
insulin-like growth factor binding protein 5

IGFBP5 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
IGFBP5 cDNA ORF Clone in Cloning Vector, Canine DG70042-G
IGFBP5 cDNA ORF Clone, Canine, untagged DG70042-UT
IGFBP5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70042-ACG
IGFBP5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70042-ACGLN
IGFBP5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70042-ACR
IGFBP5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70042-CF
IGFBP5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70042-NF
IGFBP5 cDNA ORF Clone, Canine, C-His tag DG70042-CH
IGFBP5 cDNA ORF Clone, Canine, N-His tag DG70042-NH
IGFBP5 cDNA ORF Clone, Canine, N-HA tag DG70042-NY
IGFBP5 cDNA ORF Clone, Canine, C-Myc tag DG70042-CM
IGFBP5 cDNA ORF Clone, Canine, N-Myc tag DG70042-NM

IGFBP5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
IGFBP5 cDNA ORF Clone in Cloning Vector, Rhesus CG90283-G
IGFBP5 cDNA ORF Clone, Rhesus, untagged CG90283-UT
IGFBP5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90283-ACGLN
IGFBP5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90283-ACG
IGFBP5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90283-ACR
IGFBP5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90283-CF
IGFBP5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90283-NF
IGFBP5 cDNA ORF Clone, Rhesus, C-His tag CG90283-CH
IGFBP5 cDNA ORF Clone, Rhesus, N-His tag CG90283-NH
IGFBP5 cDNA ORF Clone, Rhesus, C-HA tag CG90283-CY
IGFBP5 cDNA ORF Clone, Rhesus, N-HA tag CG90283-NY
IGFBP5 cDNA ORF Clone, Rhesus, C-Myc tag CG90283-CM
IGFBP5 cDNA ORF Clone, Rhesus, N-Myc tag CG90283-NM

IGFBP5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IGFBP5 cDNA ORF Clone in Cloning Vector, Mouse MG50444-M
IGFBP5 cDNA ORF Clone, Mouse, untagged MG50444-UT
IGFBP5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50444-ACG
IGFBP5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50444-ACGLN
IGFBP5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50444-ACR
IGFBP5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50444-CF
IGFBP5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50444-NF
IGFBP5 cDNA ORF Clone, Mouse, C-His tag MG50444-CH
IGFBP5 cDNA ORF Clone, Mouse, N-His tag MG50444-NH
IGFBP5 cDNA ORF Clone, Mouse, C-HA tag MG50444-CY
IGFBP5 cDNA ORF Clone, Mouse, N-HA tag MG50444-NY
IGFBP5 cDNA ORF Clone, Mouse, C-Myc tag MG50444-CM
IGFBP5 cDNA ORF Clone, Mouse, N-Myc tag MG50444-NM
IGFBP5 qPCR Primer Pairs, Mouse MP200453

IGFBP5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IGFBP5 cDNA ORF Clone in Cloning Vector, Human HG10206-M
IGFBP5 cDNA ORF Clone, Human, untagged HG10206-UT
IGFBP5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10206-ACG
IGFBP5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10206-ACGLN
IGFBP5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10206-ACR
IGFBP5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10206-CF
IGFBP5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10206-NF
IGFBP5 cDNA ORF Clone, Human, C-His tag HG10206-CH
IGFBP5 cDNA ORF Clone, Human, N-His tag HG10206-NH
IGFBP5 cDNA ORF Clone, Human, C-HA tag HG10206-CY
IGFBP5 cDNA ORF Clone, Human, N-HA tag HG10206-NY
IGFBP5 cDNA ORF Clone, Human, C-Myc tag HG10206-CM
IGFBP5 cDNA ORF Clone, Human, N-Myc tag HG10206-NM
IGFBP5 qPCR Primer Pairs, Human HP100265
info info
添加购物车成功! 添加购物车失败!