Быстрый заказ

Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Собачий IGF1 Информация о продукте «Клон cDNA»
Размер кДНК:462bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris insulin-like growth factor 1 (somatomedin C) with C terminal Flag tag.
Синоним гена:IGFI, IGF-I, IGFIA, IGF1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70037-ACGRBS15400
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70037-ACRRBS15400
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70037-CFRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70037-CHRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70037-CMRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70037-CYRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин клон кДНК в вектор клонированияDG70037-GRBS5130
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70037-NFRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70037-NHRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70037-NMRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70037-NYRBS13340
Собачий IGF1/IGF‑I/IGF-1 Джин ORF экспрессии кДНК клона плазмидыDG70037-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IGF I, also known as mechano growth factor, somatomedin-C, IGF-I and IGF1, is a secreted protein which belongs to the?insulin family. The insulin family, comprised of insulin, relaxin, insulin-like growth factors I and II ( IGF-I and IGF-II ) and possibly the beta-subunit of 7S nerve growth factor, represents a group of structurally related polypeptides whose biological functions have diverged. The IGFs, or somatomedins, constitute a class of polypeptides that have a key role in pre-adolescent mammalian growth. IGF-I expression is regulated by GH and mediates postnatal growth, while IGF-II appears to be induced by placental lactogen during prenatal development. IGF1 / IGF-I may be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. IGF1 / IGF-I stimulates glucose transport in rat bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. Defects in IGF1 / IGF-I are the cause of insulin-like growth factor I deficiency (IGF1 deficiency) which is an autosomal recessive disorder characterized by growth retardation, sensorineural deafness and mental retardation.

Size / Price
Каталог: DG70037-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.