After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine GABARAPL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005620674.1
Размер кДНК:354bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
Синоним гена:GABARAPL2
Виды:Canine
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70191-ACGRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70191-ACRRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70191-ANGRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70191-ANRRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70191-CFRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70191-CHRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70191-CMRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70191-CYRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70191-NFRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70191-NHRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70191-NMRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70191-NYRBS13340
Собачий GATE-16 / GABARAPL2 Джин клон кДНК в вектор клонированияDG70191-URBS5130
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмидыDG70191-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

Ссылки
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Каталог: DG70191-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».