Быстрый заказ

Text Size:AAA

Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine GABARAPL2 Информация о продукте «Клон cDNA»
Размер кДНК:354bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
Синоним гена:GABARAPL2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70191-ACGRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70191-ACRRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70191-ANGRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70191-ANRRBS15400
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70191-CFRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70191-CHRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70191-CMRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70191-CYRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70191-NFRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70191-NHRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70191-NMRBS13340
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70191-NYRBS13340
Собачий GATE-16 / GABARAPL2 Джин клон кДНК в вектор клонированияDG70191-URBS5130
Собачий GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмидыDG70191-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Каталог: DG70191-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.