Быстрый заказ

Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий FGF21 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_541510.2
    Размер кДНК:630bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris fibroblast growth factor 21 with C terminal Flag tag.
    Синоним гена:FGF21
    Виды:Canine
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70038-ACGRBS15400
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70038-ACRRBS15400
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70038-CFRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70038-CHRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70038-CMRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70038-CYRBS13340
    Собачий FGF21 Джин клон кДНК в вектор клонированияDG70038-GRBS5130
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70038-NFRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70038-NHRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70038-NMRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70038-NYRBS13340
    Собачий FGF21 Джин ORF экспрессии кДНК клона плазмидыDG70038-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-21 has a hydrophobic amino terminus, which is a typical signal sequence, and appears to be a secreted protein. The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. FGF21 is a novel adipokine associated with obesity-related metabolic complications in humans. The paradoxical increase of serum FGF21 in obese individuals, which may be explained by a compensatory response or resistance to FGF21, warrants further investigation. FGF-21, which we have identified as a novel metabolic factor, exhibits the therapeutic characteristics necessary for an effective treatment of diabetes.

    Ссылки
  • Zhang X, et al. (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 57(5): 1246-53.
  • Lundåsen T, et al. (2007) PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun. 360(2): 437-40.
  • Kharitonenkov A, et al. (2005) FGF-21 as a novel metabolic regulator. J Clin Invest. 115(6): 1627-35.
  • Size / Price
    Каталог: DG70038-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».