After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine EGFR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_533073.3
Размер кДНК:3543bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris epidermal growth factor receptor with C terminal Flag tag.
Синоним гена:EGFR
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70026-ACGRBS25660
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70026-ACRRBS25660
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70026-CFRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70026-CHRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70026-CMRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70026-CYRBS23610
Собачий EGFR/HER1 Джин клон кДНК в вектор клонированияDG70026-GRBS5130
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70026-G-HRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70026-NFRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70026-NHRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70026-NMRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70026-NYRBS23610
Собачий EGFR/HER1 Джин ORF экспрессии кДНК клона плазмидыDG70026-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

Ссылки
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • Size / Price
    Каталог: DG70026-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».