Быстрый заказ

Text Size:AAA

Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine DPYS Информация о продукте «Клон cDNA»
Размер кДНК:1557bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris dihydropyrimidinase-like with C terminal Flag tag.
Синоним гена:DPYS
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70036-ACGRBS16760
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70036-ACRRBS16760
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70036-ANGRBS16760
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70036-ANRRBS16760
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70036-CFRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70036-CHRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70036-CMRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70036-CYRBS14710
Собачий DPYS / Dihydropyrimidinase Джин клон кДНК в вектор клонированияDG70036-GRBS5130
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70036-NFRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70036-NHRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70036-NMRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70036-NYRBS14710
Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмидыDG70036-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Каталог: DG70036-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.