Быстрый заказ

Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Собачий DPYS Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_003639441.1
    Размер кДНК:1557bp
    Описание кДНК:Full length Clone DNA of Canis lupus familiaris dihydropyrimidinase-like with C terminal Flag tag.
    Синоним гена:DPYS
    Виды:Canine
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70036-ACGRBS16760
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70036-ACRRBS16760
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70036-ANGRBS16760
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70036-ANRRBS16760
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70036-CFRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70036-CHRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70036-CMRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70036-CYRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин клон кДНК в вектор клонированияDG70036-GRBS5130
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70036-NFRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70036-NHRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70036-NMRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70036-NYRBS14710
    Собачий DPYS / Dihydropyrimidinase Джин ORF экспрессии кДНК клона плазмидыDG70036-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

    Ссылки
  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Каталог: DG70036-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».